Dichos y Refranes

Descargar Genes en DOCX

Genes DOCX

Genes: 77800 Libros DOCX

  1. NIHMS742628-supplement-1.docx

     
    Tipo: Microsoft Word
    MGG_00067 F1, CCATGGTGTCTGACGTGGCTG, qRT for the genes absent in EF. MGG_00067 F2, CATGATGTGATGACATCAGC, qRT for the genes absent in  ... Table S1 Primers used in this study Primer name Sequence (5'-3 ....
    https://stacks.cdc.gov/view/cdc/37129/cdc_37129_DS2.docx
  2.  
    Tipo: Microsoft Word

  3. Genes

     
    Tipo: Microsoft Word
    MGG_00067 F1, CCATGGTGTCTGACGTGGCTG, qRT for the genes absent in EF. MGG_00067 F2, CATGATGTGATGACATCAGC, qRT for the genes absent in  ... Table S1 Primers used in this study Primer name Sequence (5'-3 ....
    http://www.mdpi.com/2073-4425/6/3/812/s1

  4. S0735109716368231_mmc1.docx

     
    Tipo: Microsoft Word
    MGG_00067 F1, CCATGGTGTCTGACGTGGCTG, qRT for the genes absent in EF. MGG_00067 F2, CATGATGTGATGACATCAGC, qRT for the genes absent in  ... Table S1 Primers used in this study Primer name Sequence (5'-3 ....
    http://www.onlinejacc.org/content/accj/68/25/2871/DC1/embed/media-1.docx?download=true

  5. annrheumdis-2017-212454-SP1.docx

     
    Tipo: Microsoft Word
    MGG_00067 F1, CCATGGTGTCTGACGTGGCTG, qRT for the genes absent in EF. MGG_00067 F2, CATGATGTGATGACATCAGC, qRT for the genes absent in  ... Table S1 Primers used in this study Primer name Sequence (5'-3 ....
    https://ard.bmj.com/content/annrheumdis/77/4/596/DC2/embed/inline-supplementary-material-2.docx?download=true

  6. Text S1, DOCX file, 0.2 MB

     
    Tipo: Microsoft Word
    MGG_00067 F1, CCATGGTGTCTGACGTGGCTG, qRT for the genes absent in EF. MGG_00067 F2, CATGATGTGATGACATCAGC, qRT for the genes absent in  ... Table S1 Primers used in this study Primer name Sequence (5'-3 ....
    https://mbio.asm.org/content/mbio/5/2/e00889-14/DC1/embed/inline-supplementary-material-1.docx?download=true

  7. S5 Table.

     
    Tipo: Microsoft Word
    MGG_00067 F1, CCATGGTGTCTGACGTGGCTG, qRT for the genes absent in EF. MGG_00067 F2, CATGATGTGATGACATCAGC, qRT for the genes absent in  ... Table S1 Primers used in this study Primer name Sequence (5'-3 ....
    https://journals.plos.org/plosone/article/file?type=supplementary&id=info:doi/10.1371/journal.pone.0181812.s011

  8. Supplemental_Methods.docx

     
    Tipo: Microsoft Word
    MGG_00067 F1, CCATGGTGTCTGACGTGGCTG, qRT for the genes absent in EF. MGG_00067 F2, CATGATGTGATGACATCAGC, qRT for the genes absent in  ... Table S1 Primers used in this study Primer name Sequence (5'-3 ....
    https://genome.cshlp.org/content/suppl/2017/08/04/gr.215566.116.DC1/Supplemental_Methods.docx

  9. Table S1 Primers used in this study Primer name Sequence (5'-3 ...

     
    Tipo: Microsoft Word
    MGG_00067 F1, CCATGGTGTCTGACGTGGCTG, qRT for the genes absent in EF. MGG_00067 F2, CATGATGTGATGACATCAGC, qRT for the genes absent in  ... Table S1 Primers used in this study Primer name Sequence (5'-3 ....
    http://journals.plos.org/plospathogens/article/file?type=supplementary&id=info:doi/10.1371/journal.ppat.1007016.s012

Libro en otros formatos:


Arriba